niman

>Seq1 [organism=Influenza A virus](A/turkey/Indiana/16-001403-1/2016(H7N8)) segment 1, polymerase PB2 (PB2) gene, complete cds. ATGGAGAGAATAAAAGAATTAAGAGATCTAATGTCACAGTCTCGCACTCGCGAGATACTAACCAAAACCACTGTT GACCACATGGCCATAATCAAAAAGTACACATCGGGAAGGCAAGAGAAGAACCCCGCACTCAGGATGAAATGGAT GATGGCAATGAAATATCCAATCACAGCAGATAAGCGAATAATGGAAATGATCCCTGAAAGGAATGAACAAGGGC AAACCCTCTGGAGCAAAACAAACGATGCCGGATCAGACCGAGTGATGGTATCACCTCTGGCTGTGACATGGTGGA ATAGGAATGGACCAACAACAAGTACAATTCACTACCCAAAGGTATATAAAACTTATTTCGAAAAAGTTGAAAGATT GAAACACGGGACCTTTGGCCCTGTACACTTCAGAAACCAAGTTAAGATAAGACGGAGAGTCGACATAAACCCGGG CCATGCTGACCTCAGTGCCAAAGAGGCGCAGGATGTAATCATGGAAGTTGTCTTTCCAAATGAAGTGGGAGCGAG AATACTGACATCGGAGTCACAACTGACAATAACAAAGGAGAAGAAGGAAGAACTCCAGGACTGCAAAATCGCCC CTCTGATGGTTGCATACATGCTAGAAAGAGAGTTGGTCCGCAAGACGAGGTTTCTCCCAGTGGCTGGTGGAACAA GCAGTGTCTACATTGAGGTGCTGCATCTGACCCAGGGGACATGCTGGGAGCAGATGTATACTCCAGGAGGAGAA GTGAGAAACGATGATGTAGACCAGAGCTTGATTATTGCTGCCAGGAACATAGTAAGAAGAGCAACAGTATCAGCA GACCCACTAGCGTCTCTATTGGAGATGTGCCACAGCACACAAATTGGGGGAATAAGGATGGTAGACATTCTTCGG CAAAATCCAACAGAGGAACAAGCCGTGGACATATGCAAGGCAGCAATGGGCCTGAGGATTAGCTCATCTTTCAGC TTCGGTGGATTCACTTTTAAAAGAACAAGTGGATCGTCAGTCAAAAGAGAAGAAGAAGTGCTTACGGGCAACCTT CAGACATTGAAAATAAGAGTACATGAGGGATATGAAGAGTTCACAATGGTTGGAAGAAGAGCAACGGCCATTCT CAGGAAGGCAACCAGAAGGCTGGTCCAGCTAATAGTAAGTGGAAGAGACGAGCAGTCAATTGCTGAAGCAATAA TTGTGGCCATGGTATTCTCACAAGAGGACTGCATGATTAAGGCAGTTCGAGGTGACCTGAATTTTGTCAATAGGGC GAACCAGCGGCTGAACCCAATGCATCAACTCTTGCGACACTTCCAAAAGGATGCAAAAGTGCTTTTCCAAAATTGG GGAATTGAACCCATTGACAATGTTATGGGAATGATCGGGATATTGCCCGACATGACCCCAAGTACTGAAATGTCG CTGAGGGGAATAAGAGTCAGTAAGATGGGAGTAGATGAATACTCCAGTACAGAGCGGGTAGTAGTAAGCATCGA CCGATTTTTAAGAGTTCGAGACCAACGGGGGAACGTACTATTGTCACCCGAGGAAGTCAGCGAGACACAAGGAAC GGAGAAATTGACAATCACTTATTCGTCATCAATGATGTGGGAGATCAATGGTCCTGAGTCGGTGTTGGTCAATACC TATCAGTGGATAATCAGAAACTGGGAAACTGTAAAAATTCAATGGTCACAGGATCCCACAATGTTGTATAATAAGA TGGAGTTCGAGCCATTTCAGTCTCTAGTCCCTAAGGCAGCCAGAGGTCAATACAGTGGGTTCGTGAGGACACTATT CCAGCAAATGCGAGATGTGCTTGGAACATTTGACACTGTTCAGATAATAAAACTCCTCCCCTTTGCTGCTGCCCCAC CGGAGCAAAGTAGGATGCAGTTCTCCTCCCTGACTGTGAATGTGAGAGGATCAGGAATGAGAATACTGGTAAGA GGCAATTCCCCGGTGTTCAATTACAACAAGGCCACCAAGAGGCTCACAGTTCTCGGGAAAGATGCAGGTGCATTG ACCGAAGATCCAGATGAAGGCACAGCTGGAGTGGAGTCTGCTGTTTTAAGAGGATTCCTCATTTTGGGCAAAGAA GACAAGAGATATGGCCCAGCACTGAGCATCAATGAGCTGAGCAATCTTGCAAAGGGAGAGAAGGCTAATGTGCT AATTGGGCAAGGAGACGTAGTGTTGGTGATGAAACGGAAACGGAACTCTAGCATACTTACTGACAGCCAGACAG CGACCAAAAGAATTCGGATGGCCATCAATTAGTGTCGAA

CENTER FOR VETERINARY BIOLOGICS NOTICE NO. 16-02 TO: Biologics Licensees, Permittees, and Applicants Directors, Center for Veterinary Biologics Veterinary Services Leadership Team FROM: Byron Rippke Director SUBJECT: Availability of Avian Influenza Isolate and Sequence Information I. PURPOSE The purpose of this notice is to furnish interested parties with the genetic sequences from the H7N8 highly pathogenic avian influenza (HPAI) virus and low pathogenic (LPAI) viruses isolated from turkeys in Indiana on January 15, 2016. The notice is also to inform interested parties that the HPAI isolate will be available for purchase from the National Veterinary Services Laboratories (NVSL) by mid-February 2016. II. BACKGROUND The National Veterinary Services Laboratories confirmed H7N8 HPAI in a commercial turkey flock experiencing significant mortality in Dubois County, Indiana, on January 15, 2016. Subsequent H7N8 detections were found to be H7N8 LPAI. Based upon the full genome sequence, the index HPAI case and subsequent LPAI viruses detected in turkeys are all of North American wild bird lineage with high similarity across all eight gene segments to other wild bird viruses collected from Midwest and western states between 2011 and 2013. North American H7N8 LPAI virus has been detected previously in wild bird surveillance in the United States, but this is the first instance of H7N8 HPAI virus detection in any species. Further information on the H7N8 findings is available in the Newsroom 2016 section at https://www.aphis.usda.gov/wps/portal/aphis/newsroom/news. III. ACTION Veterinary Services is making the HPAI genomic sequence, as well as the HPAI virus courtesy of the Indiana State Board of Animal Health, available to facilities to encourage disease research and development to benefit the U.S. poultry industry. The complete genomic sequence for the HPAI can be found in the attached file. Sequence information has also been submitted to GenBank and will be available for both HPAI and LPAI viruses soon under accessions as follows: H7N8 HPAI KU558903-8910; H7N8 LPAI KU585905-12 and KU585913-20. Animal and Plant Health Inspection Service Veterinary Services Center for Veterinary Biologics 1920 Dayton Avenue PO Box 844 Ames, IA 50010 (515) 337 -6100 CENTER FOR VETERINARY BIOLOGICS NOTICE NO. 16-XX Page 2 An Equal Opportunity Provider and Employer Available isolate: • A/turkey/Indiana/16-001403-1/2016 – courtesy of the Indiana State Board of Animal Health Biologics firms that wish to obtain samples of these isolates for research purposes should: A. Contact the NVSL Diagnostic Virology Laboratory at (515) 337-7551 for guidance regarding the appropriate forms and payments to submit. B. Submit the completed forms and the payment associated with the order by one of the following methods: 1. Mail: NVSL User Fees, Box 844, Ames, Iowa 50010 2. Email: [email protected]. The NVSL will inform customers when the virus is ready to ship. C. Note that the HPAI isolate must be transferred in compliance with the Select Agent Regulations. No Material Transfer Agreement will be required. This isolate is a not pre-tested Master Seed; it is being made available for research and development. The availability of this isolate does not infer any impending change in vaccination policy. IV. IMPLEMENTATION/ APPLICABILITY The HPAI sequence is posted in this announcement, and the referenced reagent will be available from the NVSL no later than February 15, 2016.

Veterinary Services is making the HPAI genomic sequence, as well as the HPAI virus courtesy of the Indiana State Board of Animal Health, available to facilities to encourage disease research and development to benefit the U.S. poultry industry. The complete genomic sequence for the HPAI can be found in the attached file. Sequence information has also been submitted to GenBank and will be available for both HPAI and LPAI viruses soon under accessions as follows: H7N8 HPAI KU558903-8910; H7N8 LPAI KU585905-12 and KU585913-20. https://www.aphis.usda.gov/animal_health/vet_biologics/publications/notice_16_02.pdf

Florida Zika Virus cases rise to 12; mosquito that carries virus common in stateWFLA Web StaffPublished: February 4, 2016, 11:49 am Updated: February 4, 2016, 3:44 pmTAMPA, Fla. (WFLA) — The number of Florida residents diagnosed with the Zika Virus has grown from 9 to 12, Florida Governor Rick Scott said on Thursday afternoon. One of the additional cases is in Hillsborough County, bringing the total number of Hillsborough cases to three. Scott and State Surgeon General Dr. John Armstrong held a news conference at the Hillsborough County Health Department in Tampa to update Florida citizens about the state’s preparedness efforts. “My responsibility as governor is to keep people safe,” said Scott. Scott also announced on Thursday that the number of Florida counties with residents diagnosed with the virus has grown to five. Broward was added to the list of counties. Scott declared a health emergency Wednesday in Miami-Dade, Lee, Hillsborough and Santa Rosa counties. Governor Scott on Thursday said he is asking Surgeon General Dr. John Armstrong to amend the declaration of public health emergency to include Broward County. Just this week a second person in Hillsborough County was diagnosed with the Zika Virus. All of those diagnosed are believed to have contracted the virus while traveling outside of the U.S., none are pregnant women. Scott emphasized the need for everyone to be prepared, from residents to agencies. He said the Zika preparation process is similar to that of hurricanes. “We’re preparing for the worst and hoping for the best.” “We are working with the CDC to get everything we need,” he added. “We are doing everything we can to prepare.” Armstrong said that the state of Florida will use two types of tests to diagnose the Zika Virus. One test determines if a person has the active virus. The second, an antibody test, determines if a person has had the Zika virus. Scott has asked the CDC to provide at least 1,000 Zika antibody tests so the state can test individuals, especially pregnant women and new mothers, who have traveled to affected areas and had symptoms of Zika. The antibody test allows the state to see if individuals ever had the Zika virus. Florida currently has the capacity to test only 475 people. Scott also authorized the Department of Health to immediately purchase 4,000 more Zika antibody tests to ensure the state has the resources to quickly respond. During Thursday’s news conference, Scott also said that the mosquito that carries the Zika Virus is common in Florida. He urged Floridians to avoid contact with mosquitoes by putting screens up, getting rid of standing water and using bug repellent. Scott is asking Florida’s Department of Agriculture to find out how much funding is available for mosquito control. He said the preparation process for the Zika Virus is similar to that of hurricanes. “We’re preparing for the worst and hoping for the best.” The Zika virus is linked to brain deformities in babies and is causing concern among public health officials worldwide. The virus is primarily spread through mosquito bites, but investigators had been exploring the possibility it could be sexually transmitted. http://wfla.com/2016/02/04/florida-governor-surgeon-general-to-discuss-zika-readiness-thursday-in-tampa/

Center for Policy, Planning and Evaluation Administration Division of Epidemiology-Disease Surveillance and Investigation February 1, 2016 Health Notice for Health Care Providers Update on Zika Virus Disease Testing Summary In the District of Columbia Department of Health (DOH) January 21, 2016 health notice (http://doh.dc.gov/page/health-notices) we asked health care providers to consistently collect travel history information during the clinical evaluation of patients, and to promptly report suspected cases of travel-associated illnesses, including Zika virus disease. We have received a number of phone calls and emails regarding Zika and wanted to share additional important points on testing requirements that have been set by the Centers for Disease control and Prevention (CDC) and guidance about reporting cases. Zika Virus Disease Background Zika is a flavivirus transmitted by mosquitoes. It is closely related to yellow fever, dengue, and West Nile Viruses and is endemic in some areas of Africa and Asia. It is transmitted by Aedes mosquito spp., which is found in tropical and sub-tropical areas throughout the world. The first transmission reported outside of Asia and Africa occurred in 2007.1 Zika virus infection generally presents with a mild illness, characterized by low grade fever (< 38.5°C) and a maculopapular rash, but can include symptoms such as myalgias/arthralgias, headache, conjunctivitis, pain behind the eyes, and vomiting. Severe disease is uncommon and no deaths have been reported.2 Important points to note when evaluating patients, considering testing, and reporting cases  When considering a diagnosis of Zika please ensure your patient traveled to a Zika-affected area (http://www.cdc.gov/zika/geo/) and review their symptom history.  At this time the CDC will NOT test samples from patients with only a positive travel history.  Patients must have a positive travel history AND development of symptoms consistent with Zika within two weeks of travel in order for testing to be performed.  For pregnant women with a positive travel history, additional screening measures are recommended, regardless of symptom status, and can be found in the resource below entitled “CDC MMWR: Interim Guidelines for Pregnant Women During a Zika Virus Outbreak — United States, 2016.” 2  Remember to fill out the Communicable Disease Case Report Form for suspected cases (http://doh.dc.gov/publication/communicable-disease-case-report-form) and fax it to (202) 442- 8060.  Please let the patient know to expect a call from us once you submit the report form with their contact information. o Do not instruct patients to call us on their own. o We will interview all patients, even those with a positive travel history but without symptoms of Zika.  When calling with Zika virus inquires please leave a direct number where you can be reached and not the general number for your facility. This will help expedite our response. If you have any questions regarding this important issue, you may contact the Division of Epidemiology–Disease Surveillance and Investigation: Phone: (202) 442-8141 (8:15am-4:45pm) | 1-844-493-2652 (after-hours calls) Fax: (202) 442-8060 Email: [email protected] Additional Resources  Information from the CDC on Zika virus: http://www.cdc.gov/zika  DCDOH Health Notice for Health Care Providers (http://doh.dc.gov/sites/default/files/dc/sites/doh/page_content/attachments/Zika EVD update H AN%2001_21_2016%20FINAL.pdf)  CDC MMWR: Interim Guidelines for Pregnant Women During a Zika Virus Outbreak — United States, 2016 (http://www.cdc.gov/mmwr/volumes/65/wr/mm6502e1.htm)  CDC MMWR: Interim Guidelines for the Evaluation and Testing of Infants with Possible Congenital Zika Virus Infection — United States, 2016 (http://www.cdc.gov/mmwr/volumes/65/wr/mm6503e3er.htm)  Information on the possible association with microcephaly: http://www.cdc.gov/zika/pdfs/possibleassociation-between-zika-virus-and-microcephaly.pdf  Additional instructions for submitting specimens for Zika virus testing: http://www.cdc.gov/ncezid/dvbd/specimensub/arboviral-shipping.html  Information on protection against mosquitoes: http://wwwnc.cdc.gov/travel/yellowbook/2016/the-pretravel-consultation/protection-against-mosquitoes-ticks-other-arthropods  Information from the CDC on the 2014 EVD outbreak in West Africa: http://www.cdc.gov/vhf/ebola/outbreaks/2014‐west‐africa/. References 1. World Health Organization Western Pacific Region. Zika virus. (May 2015). Retrieved January 6, 2016, from: http://www.wpro.who.int/mediacentre/factsheets/fs_05182015_zika/en/ 2. Centers for Disease Control and Prevention. Zika virus. (December 2015). Retrieved January 6, 2016, from http://www.cdc.gov/zika/index.html http://doh.dc.gov/sites/default/files/dc/sites/doh/page_content/attachments/Zika update HAN 02_01_2016 FINAL.pdf

Map update https://www.google.com/maps/d/edit?hl=en&hl=en&authuser=0&authuser=0&mid=zv94AJqgUct4.kT4qLMXp3SLU

Scott adds Broward to Zika emergency order TAMPA — Florida Gov. Rick Scott said Thursday the state has three new cases of Zika and he's adding a fifth county — Broward in South Florida — to his health emergency declaration. At a news conference in Tampa, Scott said the 12 cases in Florida are all from people who became infected with the mosquito-borne virus when they traveled to other countries. Florida's warm climate, year-round mosquitoes and revolving door of international travelers make it vulnerable, but local governments have a history of fighting off similar viruses. On Wednesday, Scott signed the emergency order to cover Miami-Dade, Lee, Hillsborough and Santa Rosa counties. Scott says the state is preparing like it would for a hurricane and wants residents and tourists to know Florida is safe. He asked the Centers for Disease Control and Prevention for 1,000 kits to test for Zika antibodies, on top of about 500 the state already has. http://www.orlandosentinel.com/health/os-rick-scott-zika-virus-20160204-story.html

Three More Zika Confirmed Cases In Florida, including Broward County. http://www.orlandosentinel.com/health/os-rick-scott-zika-virus-20160204-story.html

Map update https://www.google.com/maps/d/edit?hl=en&hl=en&authuser=0&authuser=0&mid=zv94AJqgUct4.kT4qLMXp3SLU

Pregnant Woman Among 3 Zika Cases Confirmed in DCBy Matthew StableyA pregnant woman is one of the three confirmed cases of the Zika virus in the District of Columbia, according to the Department of Health.Each individual who contracted the virus traveled outside the United States.One patient who caught the virus in 2015 had visited South America.In the two 2016 cases, including the pregnant woman, one traveled to South America and another traveled to Central America.Zika is transmitted from infected mosquitoes to people, from infected pregnant mothers to babies and possibly through sexual activity, according to ongoing research. The virus usually causes a mild illness, but babies born to mothers with the virus can have microcephaly, a condition associated with small, undeveloped brains. Published 6 minutes agohttp://www.nbcwashington.com/news/health/Pregnant-Woman-Among-3-Zika-Cases-Confirmed-in-DC-367710051.html

Details released on 3 Zika confirmed travelers from Washington, DC. http://www.nbcwashington.com/news/health/Pregnant-Woman-Among-3-Zika-Cases-Confirmed-in-DC-367710051.html

First confirmed Zika patient in Virginia speaks Associated Press, 13NewsNow.com2:18 p.m. EST February 4, 2016HARRISONBURG, Va. (AP) - A Harrisonburg mother of three has been diagnosed with the first known case of the Zika virus in the state.Heather Baker tells media outlets that she received a letter dated Feb. 1 from the Centers for Disease Control and Prevention confirming that she has Zika virus. Baker thinks she contracted the virus in November while on a mission trip in Guatemala.She says the first symptom was a swollen lymph node on the side of her head. She then began experiencing joint pain, a rash and body aches.Zika is transmitted from infected mosquitoes to people, from infected pregnant mothers to babies and possibly through sexual activity. Babies born to mothers with the virus can have birth defects.Baker says she is managing her symptoms and trying to be cautious. http://www.13newsnow.com/story/news/local/virginia/2016/02/04/first-confirmed-zika-patient-virginia-speaks/79827640/

Putnam County Health Department Issues a Zika Virus NoticeTravelers with Zika symptoms are eligible for free testing.Southeast-Brewster, NY By LANNING TALIAFERRO (Patch Staff) - February 4, 2016 12:23 pm ET Putnam County residents who have traveled to areas where Zika virus infection is ongoing—and who have symptoms—can take advantage of free advanced testing by the New York State Department of Health (NYSDOH). Testing is currently not available through commercial laboratories. Symtomatic residents can visit their personal healthcare provider who will work with the Putnam County Department of Health (PCDOH) to facilitate the proper testing procedure through the NYSDOH laboratory at Wadsworth Center. Wadsworth is one of only three state laboratories in the country equipped to perform the screening and confirmatory tests of Zika antibodies and other related viruses. “We urge any county resident who has traveled to one of the infected areas and has symptoms of Zika virus infection to visit their doctor promptly,” said County Executive MaryEllen Odell. “A New York State Department of Health Zika virus information line has also been established,” she added. The number is 1-888-364-4723. “Symptoms of Zika virus infection are usually mild,” explained Putnam County’s Interim Health Commissioner, Michael Nesheiwat, MD. “Fever, rash, joint pain and conjunctivitis, or red eyes, are common ones that usually begin two to seven days after being bitten by an infected mosquito. The bigger problem appears to be a link to microcephaly, a birth defect that results from stunted brain development, so the infection is of utmost concern for pregnant women.” Symptoms can last from several days to one week. Severe infection requiring hospitalization is uncommon and fatalities are rare. To date local transmission of Zika infection has been identified in at least 14 countries and territories, including Puerto Rico, the U.S. Virgin Islands and the Caribbean, and further spread in the region is considered likely. The Centers for Disease Control and Prevention (CDC) will update their travel notices accordingly at http://wwwnc.cdc.gov/travel/notices All travelers to any of these areas should make prevention the highest priority. Wear long sleeves and pants, and use repellant products registered with the US Environmental Protection Agency (EPA), carefully following the directions. Pregnant women or those trying to become pregnant should consider postponing travel to these regions. The mosquito that carries the Zika virus is an aggressive, daytime biting variety. Confirmed Zika virus infection cases have been identified in the continental U.S., including New York State. No local transmission by mosquitoes has occurred in this country, but education and surveillance efforts are being enhanced. Prior to 2015, outbreaks of the virus had occurred only in areas of Africa, Southeast Asian and the Pacific Islands. Last May the first confirmed cases were reported in Brazil. The Zika virus cannot be passed on through casual person-to-person contact. The CDC has confirmed a case in Texas of Zika virus infection through sexual transmission. The situation regarding Zika virus is changing rapidly as new information develops. Zika virus infection is transmitted by the same Aedes mosquito that carries dengue and chikungunya virus, which made headlines last year. This is a tropical mosquito that has trouble surviving in winter weather. The PCDOH and the NYSDOH plan to monitor mosquitos in the Hudson Valley when the warmer weather returns. Only one lone mosquito of this species has been detected in Putnam County since 1999 when surveillance began. Surveillance will continue, as well as enhanced testing of other species for Zika virus. Further information on Zika virus is available at http://wwwnc.cdc.gov/travel/diseases http://patch.com/new-york/southeast/putnam-county-health-department-issues-zika-virus-notice

Colombia warns on Zika baby riskDavid ShukmanScience editor41 minutes ago From the sectionScience & Environment commentsImage captionColombian health officials have been closely monitoring the situation in BrazilHealth officials in Colombia are warning that as many as 600 babies could be born with microcephaly this year. With the second highest rate of Zika virus infections after Brazil, Colombia has more than 2,000 pregnant women showing symptoms. Microcephaly is the condition in which babies are born with brains that are smaller than normal. The Colombian authorities have watched events in Brazil. They say they are determined to avoid another tragedy on the same scale. As in Brazil, large parts of the country host the Aedes aegypti mosquito blamed for spreading the virus and face similar conditions of tropical heat, surface water and poor sanitation. One of the worst-affected areas in Colombia is the northern state of Atlantico with its densely-populated industrial centre of Barranquilla. No cases of microcephaly have been reported so far but the state's Health Secretary, Armando de la Hoz, told the BBC that the potential for harm from the Zika outbreak had now made it the top health priority. "Based on Brazilian projections, we have estimated that in Colombia for this year we will have approximately 600 births with microcephaly. "Therefore each of the women that are pregnant have a specific health care protocol - with permanent follow-up so we can confirm in utero before the microcephaly is present at birth." Early monthsUnder a plan developed late last year, when the first cases emerged, pregnant women are encouraged to report any symptoms of Zika and their pregnancies are then followed carefully. The aim is to gather as much data as possible on the spread of the virus and of its assumed links with microcephaly. Clara Inez Collazos, in her ninth month of pregnancy, is among those being monitored closely. We watched her giving the latest of many blood samples. She said she became pregnant last May and then started developing symptoms of Zika during November and December. "I didn't know I had it but when I had the symptoms I went to the doctor and I was really already coming out of the disease. They gave me the medication that I needed and he also recommended the mandatory ultrasounds. "Thank God everything was ok. I was already over the first months which are the most dangerous. "The truth is that only now I have come to realise how dangerous this illness is, because at this point the illness is not so spread out as it is in Brazil with all the kids with microcephaly. So just now we're understanding what this really is." The blood samples are sent for analysis by a specialist laboratory in the capital Bogota and the results then take about three weeks to be returned - so, as in Brazil, there is a desperate need for a faster system of diagnosis. Alarm bellsNerys Jimenez, two months pregnant, is one of many waiting for results. She said: "For three days I had fever, my body was aching, my eyes were red, and I had a rash. "I'm feeling better now but I have persistent headache, it is a splitting headache that doesn't go away. "A lot of people have told me that if I have Zika my baby can be born deformed because of the illness." As in many parts of Latin America, with carnival season just getting under way, authorities in Barranquilla are braced for an upsurge in Zika infections. Huge crowds are due to gather in the narrow streets to enjoy the spectacle and, despite intense spraying by insecticide in recent days, there is a constant risk of widespread biting by mosquitoes. And there is a new concern as well. A case of sexual transmission, confirmed by the US authorities in Texas earlier this week, has rung alarm bells here. As the city's health secretary, Mr de la Hoz puts it, the carnival is part of a culture which is open to sexual experiences. "With the information we are getting from the US, with Zika being transmitted via sexual encounters, we need to multiply our efforts to avoid people contracting the disease in this way." The city is providing condoms but there is no guarantee they will be used. One member of a carnival dance troupe, Margarita Mendoza, said that people shed their inhibitions during the festival. "People lose their sense, lose her mind, go crazy, we try to help with condoms but the people have the last word they choose if wear a condom or not."

Colombia Warns Of 600 Zika Microcephaly Cases In 2016 http://www.bbc.com/news/science-environment-35498424

4 More Patients Tested for Zika in North TexasThe county's first two confirmed Zika patients have fully recovered, according to health officials.By Frank HeinzOfficials in North Texas have tested four additional patients for Zika virus and are awaiting the results, according to the Dallas County Health and Human Services.The specimens were submitted to the Centers for Disease Control and Prevention for testing. Authorities have not released further details about the specimens or said when the results are expected. Va. Woman Contracts Zika on Mission Trip to GuatemalaTwo Zika patients confirmed in North Texas earlier this week have fully recovered from the virus, according to the DCHHS. Those cases involved a person who traveled to Venezuela and had sexual contact with another person upon returning to Dallas, officials said. Not much is known about the Dallas patients except that neither was pregnant and there was no risk to a developing fetus. Zika Virus Spreads Across the Americas, May Be Connected to Birth Defect County health officials conducted mosquito surveillance near where the patients lived and did not identify any mosquito activity. The Zika virus is usually spread through mosquito bites. DCHHS said Tuesday that the Centers for Disease Control and Prevention confirmed the second Zika diagnosis, while the county health department confirmed through a follow-up interview with the patient that the virus had been sexually transmitted. Florida Gov. Declares Zika Emergency With 9 Cases ReportedThe CDC previously said it was aware of reports of the virus being spread through sexual contact, but had not confirmed the transmission method. Common symptoms of Zika virus include fever, rash, joint pain, and conjunctivitis (red eyes). The illness is usually mild with symptoms lasting several days to a week, Dallas County health officials said. UPDATEDTexas Zika Case Is the 1st Transmitted in U.S.: CDCThe virus can have far more harmful effects on women who are infected while pregnant. Zika has led to reports of microcephaly in infants ad other "poor pregnancy outcomes," according to the CDC. Those with symptoms, or those who have had sexual contact with someone who has symptoms, are urged to seek immediate medical care, to protect themselves from further mosquito bites and to avoid unprotected sexual contact. Published 2 hours agohttp://www.nbcnewyork.com/news/national-international/Dallas-County-Health-Awaiting-Results-on-Four-Additional-Zika-Tests-367685201.html

Map updated https://www.google.com/maps/d/edit?hl=en&hl=en&authuser=0&authuser=0&mid=zv94AJqgUct4.kT4qLMXp3SLU

Va. Woman Contracts Zika on Mission Trip to GuatemalaLongtime missionary Heather Baker, who lives in Harrisonburg, Virginia, was diagnosed with Zika last week.A Virginia mother of three has been diagnosed with the first known case of the Zika virus in the state after traveling to Guatemala on a mission trip. Longtime missionary Heather Baker, who lives in Harrisonburg, Virginia, was confirmed last week to have contracted the virus. She told News4 she knew something was wrong starting in late November, when she returned from a trip to Guatemala, her fourth such trip in the past year and a half. UPDATED"It began with just a swollen lymph node, which definitely tipped me off that something was coming, and then progressed to some body aches and a really weird rash and joint pain," Baker said. She initially was tested for another illness, but those results came back negative. After talking with friends in Guatemala, she decided to get tested for Zika. State Department of Health officials told her last week she has the virus. Zika Virus Spreads Across the Americas, May Be Connected to Birth Defect Zika is transmitted from infected mosquitoes to people, from infected pregnant mothers to babies and possibly through sexual activity, according to ongoing research. Babies born to mothers with the virus can have microcephaly, a condition associated with small, undeveloped brains. Although Zika is not airborne or easily spread, Baker said she's being extra cautious. She said she stopped sharing drinks or food with her children, and canceled a massage and nail salon appointments. "We're just being very careful because there are so many unknowns," she said. Baker advised women who are pregnant or hope to get pregnant to avoid travel to affected regions, echoing experts' advice. UPDATED"If you have a trip planned to one of these area, just postpone it," she said. "Find something to do local." The Centers for Disease Control plans to release guidance soon on how to prevent sexual transmission of Zika. "We have to have a healthy respect for this virus, but I don't think we have to be unduly alarmed just yet," Georgetown University infectious disease expert Paul Rope said. Baker likely contracted Zika in Central America, but she said when she is fully recovered, she plans to return there to continue her missionary work. Published at 11:58 PM EST on Feb 3, 2016http://www.nbcnewyork.com/news/national-international/First-Zika-Virus-Patient-in-Virginia-Speaks-367616001.html

First Zika confirmed case in Virginia identified as Harrisonburg missionary infected in Guatemala. http://www.nbcnewyork.com/news/national-international/First-Zika-Virus-Patient-in-Virginia-Speaks-367616001.html

NY expands free Zika virus testing for pregnant women Mosquitoes transmit the Zika virus (Associated Press)PrintEmailBy James T. Mulder | [email protected] Follow on Twitter on February 04, 2016 at 1:29 PM, updated February 04, 2016 at 1:45 PM1share SYRACUSE, N.Y. -- The state announced today it will provide free Zika virus testing to all pregnant women who have traveled to areas where the virus is spreading, even if they don't have any symptoms. The state's Wadsworth Center in Albany is already testing symptomatic New Yorkers who have recently traveled to affected areas, but decided to expand testing because of concerns about birth defects associated with Zika virus. A rapidly growing outbreak of Zika in the Caribbean islands and Latin American countries has been declared a public health emergency by the World Health Organization. The mosquito-borne virus has been linked to cases of microcephaly, in which babies are born with underdeveloped brains. There have been 4,000 cases of microcephaly reported in Brazil. The type of mosquitoes that transmit Zika are not found in Central New York. There have been 11 positive cases of Zika virus infection among New York State residents. One is a Monroe County resident and the rest live downstate. All of them traveled to countries where Zika virus is spreading. U.S. women who are pregnant are being advised to postpone travel to areas where the Zika virus is being transmitted. Those areas include Puerto Rico, Mexico and countries in the Carribean, Central American and South America. Additionally, the federal Centers for Disease Control and Prevention is now recommending that pregnant women abstain from sex or utilize condoms for all sexual activities for the duration of their pregnancies if their male partner has traveled to or lives in an area with active Zika virus transmission. Experts say the vast majority of Zika cases are transmitted by mosquitoes. There has been one reported case in Texas of the virus being sexually transmitted. Because the symptoms of Zika virus infection are usually very mild, many people might not even realize they have been infected and typically recover without any issues. Pregnant women who have traveled to a country where Zika is spreading can learn how to get tested by calling the state Health Department at 1-888-364-4723. Contact James T. Mulder anytime: Email | Twitter | 315-470-2245 http://www.syracuse.com/health/index.ssf/2016/02/ny_expands_free_zika_virus_testing_for_pregnant_women.html

New York State to Offer Free Zika Testing for Pregnant TravelersBy SHARON OTTERMANFEB. 4, 2016 Gov. Andrew M. Cuomo on Thursday announced that New York State would offer free testing for all pregnant women who have traveled to a country affected by the Zika epidemic, regardless of whether they show symptoms. The new initiative is expected to significantly expand the number of blood tests being conducted in New York for the virus, raising issues about additional capacity as New York City’s lab rushes to develop the ability to conduct the test. In New York, hospitals and clinics are reporting that they are being told that the current wait time for lab results is between two and four weeks. At New York University Hospital, for example, none of the roughly 15 tests sent out have been returned. The city health department said Thursday that it generally received positive results in about seven days, but that the wait for an additional test that confirms the person is negative took longer. “Capacity is one of the challenges,” said Dr. Jay Varma, deputy commissioner of the New York City Department of Health. “Nobody ever planned for having capacity testing for the Zika virus, as it was considered relatively benign before this current outbreak.” On Monday, the governor had announced free testing for any New Yorkers who showed symptoms of the virus and who had recently traveled to an affected country. http://www.nytimes.com/2016/02/05/nyregion/new-york-state-to-offer-free-zika-testing-for-pregnant-travelers.html?smid=tw-nytmetro&smtyp=cur

FEBRUARY 4, 2016 Albany, NYGovernor Cuomo Announces Additional State Actions to Combat and Address ZikaState expands free testing to include all pregnant women who have traveled to countries impacted by Zika Virus DOH Issues Health Advisory to Local Health Departments, Providers and Hospitals to Coordinate Zika Response Governor Andrew M. Cuomo today directed the New York State Department of Health to expand the free Zika virus testing program for all pregnant women who have traveled to areas where the infection is ongoing, regardless of whether they exhibit symptoms. Additionally, the Department of Health has issued a health advisory to local health departments, health care providers and hospitals to further coordinate Zika response efforts in New York State. “These actions will help us continue to ensure the safety of New Yorkers,” said Governor Cuomo. “We are in constant communication with the federal Centers for Disease Control and Prevention and are taking proactive steps to raise public awareness, address any potential cases of Zika, and protect the public health. Anyone who visited countries impacted by this virus should consult with their health care professionals, and remain alert for possible symptoms.”These actions follow Monday’s announcement of free-testing for symptomatic individuals and an information line (1-888-364-4723) for the public and healthcare providers to learn more about the virus.The Wadsworth Center in Albany is already testing symptomatic New Yorkers who have recently traveled to affected areas but due to concerns regarding birth defects associated with Zika virus, DOH will expand testing to all symptomatic and asymptomatic pregnant women with recent travel history. Additionally, the CDC is now recommending that pregnant women abstain from sex or utilize condoms for all sexual activities for the duration of their pregnancies if their male partner has traveled to or lives in an area with active Zika virus transmission. DOH has issued a Health Advisory to coordinate the statewide response to Zika virus. The advisory informs healthcare providers of the expansion of the free Zika testing, and also notifies hospitals and healthcare providers that they are required to report all potential cases to their local health department to ensure a coordinated response to the virus. The advisory also provides instructions on how to handle testing of patients, and establishes a Zika information line for use by providers to interpret test results and gain updated information on the virus. Hospitals and providers must contact their local health department prior to sending samples to Wadsworth. Furthermore, the advisory provides key information on the virus and state health department expertise to local healthcare partners. DOH will continue to coordinate with the CDC and provide real-time information to county health departments and local providers regarding treatment, testing, and prevention protocols to protect New Yorkers from this emerging public health threat.There have now been 11 positive cases of Zika virus infection among New York State residents. All of the infected patients are returning travelers from countries where Zika virus is ongoing. Free testing is being done by the Wadsworth Center - one of the premier state laboratories in the nation - and includes tests to detect the presence of the virus as well as screening and confirmatory tests for antibodies against Zika and other related viruses. DOH continues to work closely with the CDC to refine the lab testing algorithm for patients and Wadsworth is already testing blood and urine based on evidence that the virus may be detectable for longer periods of time in urine."As a result of this expanded testing being offered in New York, more women and their clinicians will have better information to make the right healthcare decisions at the cutting edge of laboratory science," said DOH Commissioner Dr. Howard Zucker. "We are actively monitoring the situation and working very closely with the CDC and local health departments to protect New Yorkers from Zika virus."Because the symptoms of Zika virus infection are usually very mild, many people might not even realize they have been infected and typically recover without any issues. However, there have been reports of increased cases of a birth defect known as microcephaly that may be associated with Zika virus infection among pregnant women. DOH has received numerous inquiries from asymptomatic, pregnant women and their healthcare providers and has determined that this expansion of testing will provide pregnant women and their doctors with the valuable information they need to make the best healthcare decisions. Expanded testing will also give scientists a better understanding of the Zika virus, for which little data currently exists.Women who are pregnant and have traveled to a country where Zika is ongoing and their healthcare providers can learn how to access testing and gain additional information by calling the DOH information at: 1-888-364-4723. Additional information on Zika is availablehere on the DOH website. Contact the Governor's Press OfficeAlbany Press Office: 518.474.8418 NYC Press Office: 212.681.4640 Contact us by email:[email protected] Governor Andrew M. Cuomohttp://www.governor.ny.gov/news/governor-cuomo-announces-additional-state-actions-combat-and-address-zika

New York is offering free testing to all pregnant travelers, including those that are asymptomatic, from Zika transmitting countries. http://www.governor.ny.gov/news/governor-cuomo-announces-additional-state-actions-combat-and-address-zika

Map update https://www.google.com/maps/d/edit?hl=en&hl=en&authuser=0&authuser=0&mid=zv94AJqgUct4.kT4qLMXp3SLU

FEBRUARY 4, 2016 Albany, NYGovernor Cuomo Announces Additional State Actions to Combat and Address ZikaHEALTHSHARE State expands free testing to include all pregnant women who have traveled to countries impacted by Zika Virus DOH Issues Health Advisory to Local Health Departments, Providers and Hospitals to Coordinate Zika Response Governor Andrew M. Cuomo today directed the New York State Department of Health to expand the free Zika virus testing program for all pregnant women who have traveled to areas where the infection is ongoing, regardless of whether they exhibit symptoms. Additionally, the Department of Health has issued a health advisory to local health departments, health care providers and hospitals to further coordinate Zika response efforts in New York State. “These actions will help us continue to ensure the safety of New Yorkers,” said Governor Cuomo. “We are in constant communication with the federal Centers for Disease Control and Prevention and are taking proactive steps to raise public awareness, address any potential cases of Zika, and protect the public health. Anyone who visited countries impacted by this virus should consult with their health care professionals, and remain alert for possible symptoms.”These actions follow Monday’s announcement of free-testing for symptomatic individuals and an information line (1-888-364-4723) for the public and healthcare providers to learn more about the virus.The Wadsworth Center in Albany is already testing symptomatic New Yorkers who have recently traveled to affected areas but due to concerns regarding birth defects associated with Zika virus, DOH will expand testing to all symptomatic and asymptomatic pregnant women with recent travel history. Additionally, the CDC is now recommending that pregnant women abstain from sex or utilize condoms for all sexual activities for the duration of their pregnancies if their male partner has traveled to or lives in an area with active Zika virus transmission. DOH has issued a Health Advisory to coordinate the statewide response to Zika virus. The advisory informs healthcare providers of the expansion of the free Zika testing, and also notifies hospitals and healthcare providers that they are required to report all potential cases to their local health department to ensure a coordinated response to the virus. The advisory also provides instructions on how to handle testing of patients, and establishes a Zika information line for use by providers to interpret test results and gain updated information on the virus. Hospitals and providers must contact their local health department prior to sending samples to Wadsworth. Furthermore, the advisory provides key information on the virus and state health department expertise to local healthcare partners. DOH will continue to coordinate with the CDC and provide real-time information to county health departments and local providers regarding treatment, testing, and prevention protocols to protect New Yorkers from this emerging public health threat.There have now been 11 positive cases of Zika virus infection among New York State residents. All of the infected patients are returning travelers from countries where Zika virus is ongoing. Free testing is being done by the Wadsworth Center - one of the premier state laboratories in the nation - and includes tests to detect the presence of the virus as well as screening and confirmatory tests for antibodies against Zika and other related viruses. DOH continues to work closely with the CDC to refine the lab testing algorithm for patients and Wadsworth is already testing blood and urine based on evidence that the virus may be detectable for longer periods of time in urine."As a result of this expanded testing being offered in New York, more women and their clinicians will have better information to make the right healthcare decisions at the cutting edge of laboratory science," said DOH Commissioner Dr. Howard Zucker. "We are actively monitoring the situation and working very closely with the CDC and local health departments to protect New Yorkers from Zika virus."Because the symptoms of Zika virus infection are usually very mild, many people might not even realize they have been infected and typically recover without any issues. However, there have been reports of increased cases of a birth defect known as microcephaly that may be associated with Zika virus infection among pregnant women. DOH has received numerous inquiries from asymptomatic, pregnant women and their healthcare providers and has determined that this expansion of testing will provide pregnant women and their doctors with the valuable information they need to make the best healthcare decisions. Expanded testing will also give scientists a better understanding of the Zika virus, for which little data currently exists.Women who are pregnant and have traveled to a country where Zika is ongoing and their healthcare providers can learn how to access testing and gain additional information by calling the DOH information at: 1-888-364-4723. Additional information on Zika is availablehere on the DOH website. Contact the Governor's Press OfficeAlbany Press Office: 518.474.8418 NYC Press Office: 212.681.4640 Contact us by email:[email protected] Governor Andrew M. Cuomo